ORIGINAL ARTICLE | https://doi.org/10.5005/jp-journals-10082-02269 |
Identification of the Single Nucleotide Polymorphisms and their Frequency Present in the Targeted Region of POR Gene in South Indian Population
1,4Department of Central Inter-disciplinary Research Facility, Sri Balaji Vidyapeeth (Deemed to be University), Puducherry, India
2Department of Pharmacology, Mahathma Gandhi Medical College and Research Institute, Puducherry, India
3Department of Functional Genomics and Molecular Medicine Unit, CSIR-IGIB, Delhi, India
Corresponding Author: Rajalakshmi Kumar, Department of Central Inter Disciplinary Research Facility, Sri Balaji Vidyapeeth (Deemed to be University), Puducherry, India, Phone: +91 8148521992, e-mail: raji145.k@gmail.com
How to cite this article Kumar R, Chandrasekaran A, Kukreti R, Subramanian B. Identification of the Single Nucleotide Polymorphisms and their Frequency Present in the Targeted Region of POR Gene in South Indian Population. J Basic Clin Appl Health Sci 2020;3(4):158–163.
Source of support: This study was funded by Dr Vany Adithan Research Fellowship and supported by Sri Balaji Vidyapeeth (Deemed to be University).
Conflict of interest: None
ABSTRACT
Background and objectives: Cytochrome P450 oxidoreductase (POR) gene act as an electron donor to other microsomal cytochrome P450 (CYP) enzymes. This study is attempted to identify the POR genetic variants present in the proximal promoter region, hotspot coding regions that affect the function of POR gene, and the 3′UTR region encompassing miRNA binding sites among the South Indian population.
Materials and methods: Blood samples were collected from 110 south Indian subjects. Genomic DNA was isolated from whole blood and the target regions of the POR gene were amplified using specific primers. The PCR amplicons were sequenced by the Sanger method. The variants present in proximal promoter region, exons (9, 10, 11, and 12) with boundary regions around 100 bp region and 3′UTR region, were analyzed. The microRNA database (miRDB) prediction tool was used to analyze miRNA binding regions in the 3′UTR region.
Results: The SNPs (rs72553971, rs41301394, rs41301400, rs4732514, rs2286822, rs2286823, rs41301427, and rs17685) were observed in the POR gene with frequency of 2.7, 31.36, 2.27, 57.27, 23.63, 23.63, 14.54, and 35%, respectively. All these SNPs were previously reported in other populations. No novel variation has been observed in the hotspot coding region of the POR gene among South Indian population.
Conclusion: The frequency of POR gene polymorphisms is reported for the first time among the South Indian population. This study provides fundamental and useful information on POR pharmacogenetics among this population, which can be utilized for future research.
Keywords: Minor allele frequency, Polymorphism, POR gene, Single nucleotide polymorphism, South Indian..
INTRODUCTION
The human NADPH cytochrome P450 oxidoreductase (POR) gene is present in the chromosome number 7q11.2, which is approximately 72 kb in size and consists of 15 protein-coding exons, with one untranslated exon.1 The POR enzyme regulates multiple metabolic processing enzymes involved in the drug metabolism, steroidogenesis, and also xenobiotics.2,3 The POR gene is highly polymorphic and exhibits a number of variations among the individuals, which are highly responsible for the altered drug metabolic reactions that are observed in diseases like Antley-Bixler syndrome, polycystic ovarian syndrome, cytochrome P450 oxidoreductase deficiency (PORD), and congenital adrenal hyperplasia.4–7 The POR protein consists of 680 amino acids with four domains namely, flavin mononucleotide (FMN), flavin adenine dinucleotide (FAD), hinge domain and nicotinamide adenine dinucleotide domain.8,9 Flavin moieties act as a cofactor for the catalytic activity of the protein.10,11
The crucial function of the POR protein is to donate electrons through a series of reactions to many other CYP enzymes for their proper biological activity.12,13 The single nucleotide polymorphisms (SNPs) present in the gene may lead to structural and functional variation in the protein and also alters the drug metabolizing activity among the individuals.14 Each and every individual shows the differences in the drug response, which can be attributed by the variability in the DNA sequence of the POR gene both in exons as well as introns.15 Variations present in the intronic region have the potential to induce or reduce the splicing mechanism efficiency.16 The proximal promoter region of the POR gene is present immediate to the upstream of exon 1U, showing various effects of the altering hormone level in case of polymorphisms.17,18 The 3′UTR region plays an important role for binding the miRNA, to enhance the gene expression and translation process.19 Some of the SNPs in this region may inhibit the binding specificity of the miRNA.20
The worldwide study reported that the majority of protein-altering variants and disease-causing variants fall in the hotspot coding regions. The risk variants Ala287Pro and Arg457His were associated with Antley-Bixler syndrome (ABS) and the breast cancer risk was located within the region of exon 9–12 in other population.21,22 This study is attempted to assess the frequency of polymorphisms in selected regions (exon 9–12), promoter region, and 3′UTR region of the POR gene among healthy individuals of South Indian population.
MATERIALS AND METHODS
The study protocol was approved by the institutional human ethics committee and a written informed consent was obtained from the participants who satisfied the eligibility criteria.
Inclusion and Exclusion Criteria
The volunteers were of South Indian origin residing in Tamil Nadu, Kerala, Karnataka, Andhra Pradesh, and Puducherry for at least last three generations. The participants were selected with the result showing normal hematological and biochemical parameters like random blood sugar, hemoglobin, lipid profile, renal function, and routine urine test. Severe and complication illnesses like hypertension, diabetes mellitus, and asthma patients were excluded from the study. Pregnancy and lactating mothers were also omitted.
A total of n = 110 unrelated healthy volunteers aged between 18 and 65 years were randomly selected and 2 mL of peripheral venous blood was collected in an EDTA (ethylenediaminetetraacetic acid) anticoagulant tubes. Genomic DNA was isolated from whole blood using commercial kits (Qiagen, Germany) and stored at 4°C. Targeted regions in POR gene were amplified through polymerase chain reaction using appropriate forward and reverse primers (Table 1) using the following reaction conditions (Table 2). Each 35 μL reaction consists of 3 μL of genomic DNA (50 ng/μL), 17.5 μL of 10× PCR Top Taq Master Mix, 1 μL of each primer (10 pmol/μL), and 12.5 μL of nuclease free water. Amplification was performed using Veriti 96 well Thermal Cycler (Applied Biosystem, USA). The PCR products were visualized in 1% agarose gel with ethidium bromide staining.
| Amplified region | Forward primers 5′–3′ | Reverse primers 5′–3′ | Amplicon size | Ref. |
|---|---|---|---|---|
| +36_as–−325_s | TCAGGCCACACCACTGAGG | GCCCGAAGGAGGAGGCTAGA | 361 bp | 17 |
| Exon 9–10 | GTAACCGGTGAGATTTCCTCAT | ACTATGACAGTGACGGGGTAGG | 692 bp | 25 |
| Exon 11–12 | AGGGAGGCATCAGAGAGCATAG | GGCTGGACAGATGCTGAGAA | 781 bp | 25 |
| 3′UTR | GGGATGTGCAGAACACCTTC | GGTTCCTGGGGTCTGAGTTA | 572 bp | 34 |
| PCR conditions | Proximal promoter region | Exon 9–10 | Exon 11–12 | 3′UTR region |
|---|---|---|---|---|
| Initial denaturation | 95°C/3 minutes | 95°C/3 minutes | 95°C/3 minutes | 95°C/3 minutes |
| Denaturation | 95°C/1 minute | 95°C/1 minute | 95°C/1 minute | 95°C/1 minute |
| Annealing | 60°C/30 seconds | 59°C/30 seconds | 60°C/30 seconds | 59°C/30 seconds |
| Extension | 72°C/2 minutes | 72°C/1 minute | 72°C/2 minutes | 72°C/1 minute |
| Final extension | 72°C/7 minutes | 72°C/7 minutes | 72°C/7 minutes | 72°C/7 minutes |
| Infinity | 4°C | 4°C | 4°C | 4°C |
Sanger Sequencing
The sequencing of PCR products was performed by Macrogen Inc. (South Korea). The derived electropherogram (Fig. 1) was manually evaluated and confirmed by the sequence with the nucleotide BLAST. The NCBI genomic DNA NC_000007.14: 75914700–75986855 FASTA sequence was used as a reference to analyze variants. The identified intronic variants are numbered according to the NCBI reference sequence, and exons were identified from the initiation codon ATG (A is considered as +1).23 Gene sequence ID 5447 were used to predict the miRNA targeted region in the 3′UTR region. The miRDB (http://mirdb.org) online bioinformatics tool was used to predict the miRNA binding site in the 3′UTR sequences.
Figs 1A to C: Electropherogram shows that the SNP changes in the sequence of the POR gene. The black arrow indicates the SNP change: (A) Wildtype alleles CC; (B) Heterozygous alleles CA; (C) Variant alleles
Statistical Analysis
The χ2 test for goodness of fit was used to determine the genotypic distribution of each SNP following Hardy-Weinberg equilibrium (HWE) calculated using Microsoft Excel. Linkage disequilibrium (LD) was calculated using the Haploview Software version 4.1.24p values %3C; 0.05 are considered statistically significant.
RESULTS
The proximal promoter region of the POR gene sequencing showed SNPs rs72553971 and rs72553972 at the position −173 (C %3E; A) and −152 (C > A) with a frequency of 2.7 and 15.45%, respectively, in the South Indian population (Table 3). We have found 12 SNPs in the noncoding intronic region, which were located nearby the boundary of the hotspot exons and also only one variation, rs17685 (G > A), was found at the 3′UTR region of the POR gene with the frequency of 35%, in the 110 human whole blood samples (Table 3). There were three SNPs found in the ninth intronic region rs13223707 (C > G); rs13240147 (G > A); and rs41301394 (C > T) with the variant allele frequency showing 91.36, 90.45, and 31.36%. One SNP was found in the ninth intronic region rs562843415 (G > A) with the minor allele frequency was less than 1%, but their HWE value showed the significant p value > 0.05 of this variant. Four SNPs were found in the eleventh noncoding region of the POR gene, rs41301400 (G > C), rs4732514 (C > T), rs4732515 (T > C)m rs4732516 (C > G), with the frequency of variant allele: 2.27; 57.27, 91.81, and 90.45% respectively, whereby three SNPs were consistent with the HWE, except rs4732516. Two SNPs were found in the eleventh intronic region rs2286822 (C > T) and rs2286823 (G > A). Minor allele frequency of 23.63% was obtained for both of the variants, and significant differences in the p value of HWE were observed. Twelfth intronic region has two SNPs rs41301427 (G > A) and rs377357128 (G > A) with the variant allele frequency: 14.54 and 0.90%, and the p value was significant to the equilibrium. From this study, four SNPs were not in HWE (rs72553972, rs13223707, rs13240147, and rs4732516), showing p value %3C; 0.05. According to miRDB (miRNA database), POR gene is predicted to be targeted by 14 miRNAs in miRDB, but no variations were found in the miRNA binding site region in South Indian population. The comparison of the worldwide population allele frequency of the POR gene is shown in Table 4.
The linkage disequilibrium analysis was performed for all 15 SNPs obtained in the South Indian population across the POR gene-targeted regions (Fig. 2). The red color indicates the relatively strong linkage among the SNPs. The r2 value is considered as a guideline for the linkage between a pair of single nucleotide variations and D′ is indicated to determine the probability for the previous recombinations. According to the r2 value, the perfect linkage was found between the SNPs rs2286822 and rs2286823 (r2 = 1; D′ = 1). The SNPs between rs4732515 and rs4732516 relatively show strong association by the value r2 = 0.8; D′ = 1. The value D′ = 1 indicates that the SNPs were strongly linked between both the pairs rs41301394 and rs2286822; rs41301394 and rs2286823, whereas the r2 = 0.1 exhibited weak linkages.
In this study, we have found SNPs only in the intronic region, hence no SNPs were found in the exonic hotspot/protein-coding regions of the POR gene.
DISCUSSION
In recent years, there has been a huge pharmacogenomics interest on POR genetic variants. The POR gene polymorphisms have acquired great attention among researchers, due to their involvement in differential response to cytochrome-mediated drug metabolic activity, steroidogenic metabolism, and they are also indirectly associated with protein expression activity. In this study, we screened the SNPs present in the transcription start site of around 361 bp of untranslated exon (−325/+36). POR −173C %3E; A was found in the basal promoter region at a minor allele frequency of 2.7%, compared to other American populations showing that the Mexican Americans 3.1% is closely related to the South Indian population (Table 4).25 The upstream SNP of POR −173 C > A has been reported to be negatively associated with the warfarin dose and reduces the gene expression in different ethnic groups.26 The functional polymorphism of the POR proximal promoter variant −152 C > A is present at the AP-2 activator protein site, while the effect of the variant remains unclear till today.17 TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH.html) online tool showed that the putative binding domain (eg: homeodomain factor NKx2.5) present in the proximal promoter region of the POR gene.18 In connecting that, reports to neither of the two promoter region SNPs had an impact on the transcription of a 325-bp POR basal promoter in reporter gene assays.17 According to the study of Ningwu Huang et al. in the year of 2007, they screened the SNPs present in POR gene among 842 individuals of four different ethnic populations. Majority of the protein-altering SNPs identified in the exonic region of 8th to 14th were highlighted in various population.23 Hence, the 9th to 12th exons were considered as a hotspot region, while the variants Ala287Pro and Arg457His associated with ABS and breast cancer risk variant also fall within this region.21,22 The primers were considered for the hotspot region based on the research article by Huang et al. The sequenced results were analyzed with the FASTA sequence from the UCSC genome browser template, recently updated version of POR gene human assembly [Dec. 2013 (GRCh38/hg38)]. This showed that the region sequenced was not present in the 8th exon. Our ultimate aim is to find the frequency of POR gene variants in South Indian population, while the common variant Ala503Val in exon 13 was already reported in this population with their respective frequency.27 In exon 14, only one variant Tyr607Cys was previously reported in the study with the lower frequency of 0.002 in Caucasian American.25 Hence, the exon 13 and 14 has been excluded from the study. In Chinese population, three intronic variants (rs2286823, rs41301394, and rs2302429) were found to be associated with the altered CYP1A2, CYP2C19, or CYP3A4 enzyme activities, whereas in our population, the SNPs (rs41301394 and rs2286823) have been found with the MAF of 31.36 and 23.63%, respectively, which gives a hint for further pharmacogenetic research.28 The polymorphism of the Leu577Pro and rs41301427 (G > A), in other population, was associated with the decreased POR protein activity, but not in the other P450 enzyme activities.29 In the present study, we found that MAF of the SNP (rs41301427) exhibited as 14.54% in the South Indian population, which is considered as statistically significant, according to HWE.30 Henceforth, further studies need to be conducted in order to confirm the association of Leu577Pro and rs41301427 (G > A) in the South Indian population, which might bring about decreased POR activity. The SNP rs2286822 (C > T) heterozygous sample in Chinese population liver sample shows the decreased level of mRNA expression as compared as homozygous mutant and the rs2286822 and rs2286823 produce higher protein content while comparing with homozygous allele.31 The SNP rs2286822 was majorly associated with the congenital adrenal hyperplasia patients caused due to 21 hydroxylase mutations.32 According to our study, four SNPs (rs72553972, rs13223707, rs13240147, and rs4732516) were not following HWE, hence a larger sample pool may be required further to calculate the minor allele frequency. The variant associated with the ABS, Arg457His, was absent in our population. There has been an association of both intron and exon variants, which are involved in drug metabolism, majority of variant association with drug metabolism present in the POR gene remains unclear. The therapeutic effects of drugs, influencing the knowledge of POR pharmacogenomics, would help both doctors and patients to choose the proper medication and regimen, and provide better guidance for personalized medicine and reference for treatment of disease in clinic.33
| S. no. | Chromosomal position | rsID | POR gene region | Variant | Minor allele frequency (%) | Hardy-Weinberg equilibrium (p value) |
|---|---|---|---|---|---|---|
| 1 | 7:75914929 | rs72553971 | −173 proximal promoter | C>A | 2.7 | 0.7687 |
| 2 | 7:75914950 | rs72553972 | −152 proximal promoter | C>A | 15.45 | %3C;0.05 |
| 3 | 7:75983452 | rs13223707 | 8-intron | C%3E;G | 91.36 | <0.05 |
| 4 | 7:75983465 | rs13240147 | 8-intron | G>A | 90.45 | <0.05 |
| 5 | 7:75983485 | rs41301394 | 8-intron | C>T | 31.36 | 0.9366 |
| 6 | 7:75983877 | rs562843415 | 9-intron | G>A | 0.90 | 0.9233 |
| 7 | 7:75983957 | rs41301400 | 10-intron | G>C | 2.27 | 0.8073 |
| 8 | 7:75984680 | rs4732514 | 10-intron | C>T | 57.27 | 0.4548 |
| 9 | 7:75984711 | rs4732515 | 10-intron | T>C | 91.81 | 0.1087 |
| 10 | 7:75984764 | rs4732516 | 10-intron | C>G | 90.45 | <0.05 |
| 11 | 7:75984970 | rs2286822 | 11-intron | C>T | 23.63 | 0.2570 |
| 12 | 7:75984978 | rs2286823 | 11-intron | G>A | 23.63 | 0.2570 |
| 13 | 7:75985239 | rs41301427 | 12-intron | G>A | 14.54 | 0.6058 |
| 14 | 7:75985331 | rs377357128 | 12-intron | G>A | 0.90 | 0.9618 |
| 15 | 7:75986787 | rs17685 | 3′UTR | G>A | 35 | 0.8422 |
| Population | Allele frequency | Ref | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| rs 72553971 | rs 72553972 | rs 13223707 | rs 13240147 | rs 41301394 | rs 562843415 | rs 41301400 | rs 4732514 | rs 4732515 | rs 4732516 | rs 2286822 | rs 2286823 | rs 41301427 | rs 377357128 | rs 17685 | ||
| African American | 0.012 | 0.026 | – | – | 0.186 | – | 0.014 | – | 0.612 | 0.609 | 0.208 | 0.194 | 0.056 | – | – | 25 |
| Caucasian American | 0.044 | 0.13 | – | – | 0.267 | – | 0.000 | – | 0.959 | 0.959 | 0.319 | 0.317 | 0.083 | – | – | 25 |
| Chinese American | 0.015 | 0.078 | – | – | 0.368 | – | 0.000 | – | 0.867 | 0.870 | 0.360 | 0.360 | 0.056 | – | – | 25 |
| Mexican American | 0.031 | 0.077 | – | – | 0.310 | – | 0.000 | – | 0.865 | 0.869 | 0.407 | 0.407 | 0.058 | – | – | 25 |
| Japanese | – | 0.019 | – | 0.134 | 0.434 | – | 0.098 | 0.419 | 0.134 | 0.132 | 0.389 | 0.389 | 0.011 | – | 0.385 | 14 |
| South Indian | 0.027 | 0.1545 | 0.9136 | 0.9045 | 0.3136 | 0.009 | 0.0227 | 0.5727 | 0.9181 | 0.9045 | 0.2363 | 0.2363 | 0.1454 | 0.009 | 0.35 | PS |
| Moroccan Jewish | – | – | – | – | – | – | – | – | – | 0.938 | 0.393 | 0.389 | – | – | – | 14,25 |
| Ashkenazi (T) | – | – | – | – | – | – | – | – | – | 0.991 | 0.385 | 0.382 | – | – | – | 14,25 |
| Ashkenazi | – | – | – | – | – | – | – | – | – | 0.87 | 0.36 | 0.36 | – | – | – | 14,25 |
| Gomes et al. | – | – | – | – | – | – | – | – | – | – | 0.293 | 0.297 | – | – | – | 3 |
| Saito et al. | – | – | – | – | – | – | – | – | – | 0.132 | 0.389 | 0.389 | – | – | – | 3,14,25 |
| Hart et al. | – | – | – | – | – | – | – | – | – | 0.953 | 0.359 | 0.374 | – | – | 0.195 | 29,34 |
| 1000 Genomes | 0.022 | 0.1040 | 0.811 | 0.811 | 0.2749 | 0.001 | 0.0251 | 0.505 | 0.812 | 0.812 | 0.304 | 0.300 | 0.072 | 0.001 | 0.269 | 35 |
| TOPMED | 0.039 | 0.1122 | 0.837 | 0.837 | 0.2490 | 3.981 | 0.0102 | 0.569 | 0.838 | 0.837 | 0.295 | 0.288 | 0.075 | 7.964 | 0.245 | 35 |
| HapMap projects | – | – | – | – | – | – | – | – | – | 0.2701 | – | – | – | – | – | 36 |
PS, Present Study
Fig. 2: Linkage disequilibrium pattern of the analyzed polymorphisms across the target regions in POR gene in the South Indian population (LOD > 2; bright red: D = 1, shades of red/pink: D < 1; for LOD < 2: blue: D = 1, white D < 1)
LIMITATIONS OF THE STUDY
In this study, the normal allele frequency is estimated in a targeted region of the POR gene in South Indian population. For the frequency estimation in a population, small sample size is required, so we took 110 individual samples. The study can be extended further with greater sample size to estimate normal allele frequency. POR gene contains totally 15 coding exon regions, whereby we sequenced only targeted region to estimate the minor allele frequency of SNPs and if we sequence the entire gene there is possibility to get more novel variations.
CONCLUSION
In this study, we identified 15 intronic variants in the POR gene-targeted regions. Based on the linkage disequilibrium profile, the analyzed region was mentioned into blocks. This is the first study to provide information on POR gene-targeted region polymorphisms and associated LD plot in a South Indian population. The findings of this article will be useful for future pharmacogenetic, epigenetic studies and also to analyze the interindividual differences in drug metabolism of the CYP activity.
ACKNOWLEDGMENTS
We would like to thank Sri Balaji Vidyapeeth (Deemed to be University) for providing basic infrastructure facility. I personally thank Dr Benet Bosco Dhas D for his timely guidance and help to improvise the manuscript.
REFERENCES
1. Shephard EA, Phillips IR, Santisteban I, West LF, Palmer CNA, Ashworth A, et al. Isolation of a human cytochrome P-450 reductase cDNA clone and localization of the corresponding gene to chromosome 7q11.2. Ann Hum Genet 1989;53(4):291–301. DOI: 10.1111/j.1469-1809.1989.tb01798.x.
2. Lewis DFV. 57 varieties: the human cytochromes P450. Pharmacogenomics 2004;5(3):305–318. DOI: 10.1517/phgs.5.3.305.29827.
3. Gomes AM, Winter S, Klein K, Turpeinen M, Schaeffeler E, Schwab M, et al. Pharmacogenomics of human liver cytochrome P450 oxidoreductase: multifactorial analysis and impact on microsomal drug oxidation. Pharmacogenomics 2009;10(4):579–599. DOI: 10.2217/pgs.09.7.
4. Fukami M, Horikawa R, Nagai T, Tanaka T, Naiki Y, Sato N, et al. Cytochrome P450 oxidoreductase gene mutations and Antley-Bixler syndrome with abnormal genitalia and/or impaired steroidogenesis: molecular and clinical studies in 10 patients. J Clin Endocrinol Metab 2005;90(1):414–426. DOI: 10.1210/jc.2004-0810.
5. Huang N, Pandey AV, Agrawal V, Reardon W, Lapunzina PD, Mowat D, et al. Diversity and function of mutations in p450 oxidoreductase in patients with antley-bixler syndrome and disordered steroidogenesis. Am J Hum Genet 2005;76(5):729–749. DOI: 10.1086/429417.
6. Homma K, Hasegawa T, Nagai T, Adachi M, Horikawa R, Fujiwara I, et al. Urine steroid hormone profile analysis in cytochrome P450 oxidoreductase deficiency: implication for the backdoor pathway to dihydrotestosterone. J Clin Endocrinol Metab 2006;91(7):2643–2649. DOI: 10.1210/jc.2005-2460.
7. Arlt W, Walker EA, Draper N, Ivison HE, Ride JP, Hammer F, et al. Congenital adrenal hyperplasia caused by mutant P450 oxidoreductase and human androgen synthesis: analytical study. Lancet 2004;363(9427):2128–2135. DOI: 10.1016/S0140-6736(04)16503-3.
8. Xia C, Panda SP, Marohnic CC, Martásek P, Masters BS, Kim, et al. Structural basis for human NADPH-cytochrome P450 oxidoreductase deficiency. ProcNatl Acad Sci USA 2011;108(33):13486–13491. DOI: 10.1073/pnas.1106632108.
9. Campelo D, Esteves F, Palma BB, Gomes BC, Rueff J, Lautier T, et al. Probing the role of the hinge segment of cytochrome P450 oxidoreductase in the interaction with cytochrome P450. Int J Mol Sci 2018;19(12):3914. DOI: 10.3390/ijms19123914.
10. Wang M, Roberts DL, Paschke R, Shea TM, Masters BS, Kim JJ. Three-dimensional structure of NADPH-cytochrome P450 reductase: prototype for FMN- and FAD-containing enzymes. Proc Natl Acad Sci USA 1997;94(16):8411–8416. DOI: 10.1073/pnas.94.16.8411.
11. Vermilion JL, Ballou DP, Massey V, Coon MJ. Separate roles for FMN and FAD in catalysis by liver microsomal NADPH-cytochrome P-450 reductase. J Biol Chem 1981;256(1):266–277.
12. Ellis J, Gutierrez A, Barsukov IL, Huang W-C, Grossmann JG, Roberts GCK. Domain motion in cytochrome P450 reductase: conformational equilibria revealed by NMR and small-angle x-ray scattering. J Biol Chem 2009;284(52):36628–36637. DOI: 10.1074/jbc.M109.054304.
13. Montellano PROde. Cytochrome P450: structure, mechanism, and biochemistry Springer; 2015. p. 912.
14. Saito Y, Yamamoto N, Katori N, Maekawa K, Fukushima-Uesaka H, Sugimoto D, et al. Genetic polymorphisms and haplotypes of POR, encoding cytochrome P450 oxidoreductase, in a Japanese population. Drug Metab Pharmacokinet 2011;26(1):107–116. DOI: 10.2133/dmpk.dmpk-10-sc-096.
15. Hu L, Zhuo W, He Y-J, Zhou H-H, Fan L. Pharmacogenetics of P450 oxidoreductase: implications in drug metabolism and therapy. Pharmacogenet Genomics 2012;22(11):812–819. DOI: 10.1097/FPC.0b013e328358d92b.
16. Seo S, Takayama K, Uno K, Ohi K, Hashimoto R, Nishizawa D, et al. Functional analysis of deep intronic SNP rs13438494 in intron 24 of PCLO gene. PLoS ONE 2013;8(10):e76960. DOI: 10.1371/journal.pone.0076960.
17. Tee MK, Huang N, Damm I, Miller WL. Transcriptional regulation of the human P450 oxidoreductase gene: hormonal regulation and influence of promoter polymorphisms. Mol Endocrinol 2011;25(5):715–731. DOI: 10.1210/me.2010-0236.
18. Soneda S, Yazawa T, Fukami M, Adachi M, Mizota M, Fujieda K, et al. Proximal promoter of the cytochrome P450 oxidoreductase gene: identification of microdeletions involving the untranslated exon 1 and critical function of the SP1 binding sites. J Clin Endocrinol Metab 2011;96(11):E1881–E1887. DOI: 10.1210/jc.2011-1337.
19. Wei R, Yang F, Urban TJ, Li L, Chalasani N, Flockhart DA, et al. Impact of the interaction between 3′-UTR SNPs and microRNA on the expression of human xenobiotic metabolism enzyme and transporter genes. Front Genet 2012;3:248. DOI: 10.3389/fgene.2012.00248.
20. Fang Z, Rajewsky N. The impact of miRNA target sites in coding sequences and in 3’UTRs. PLoS ONE 2011;6(3):e18067. DOI: 10.1371/journal.pone.0018067.
21. Haiman CA, Setiawan VW, Xia LY, Le Marchand L, Ingles SA, Ursin G, et al. A variant in the cytochrome P450 oxidoreductase gene is associated with breast cancer risk in African Americans. Cancer Res 2007;67(8):3565–3568. DOI: 10.1158/0008-5472.CAN-06-4801.
22. McCammon KM, Panda SP, Xia C, Kim J-JP, Moutinho D, Kranendonk M, et al. Instability of the human cytochrome P450 reductase A287P variant is the major contributor to its antley-bixler syndrome-like phenotype. J Biol Chem 2016;291(39):20487–20502. DOI: 10.1074/jbc.M116.716019.
23. Antonarakis SE. Recommendations for a nomenclature system for human gene mutations. nomenclature working group. Hum Mutat 1998;11(1):1–3. DOI: 10.1002/(SICI)1098-1004(1998)11:13.0.CO;2-O.
24. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21(2):263–265. DOI: 10.1093/bioinformatics/bth457.
25. Huang N, Agrawal V, Giacomini KM, Miller WL. Genetics of P450 oxidoreductase: sequence variation in 842 individuals of four ethnicities and activities of 15 missense mutations. Proc Natl Acad Sci USA 2008;105(5):1733–1738. DOI: 10.1073/pnas.0711621105.
26. Zhang X, Li L, Ding X, Kaminsky LS. Identification of cytochrome P450 oxidoreductase gene variants that are significantly associated with the interindividual variations in warfarin maintenance dose. Drug Metab Dispos 2011;39(8):1433–1439. DOI: 10.1124/dmd.111.038836.
27. Mirunalini R, Pavithra G, Dhas DBB, Adithan C. Genotype and allele frequency of P450 oxidoreductase *28 gene polymorphism in South Indian population. J Pharmacol Pharmacotherap 2019;10(1):7–10. DOI: 10.4103/jpp.JPP_95_18.
28. Liu S, Chen R, Li J, Zhang Y, Wang X, Fu Q, et al. The POR rs1057868-rs2868177 GC-GT diplotype is associated with high tacrolimus concentrations in early post-renal transplant recipients. Acta Pharmacol Sin 2016;37(9):12518. DOI: 10.1038/aps.2016.77.
29. Hart SN, Wang S, Nakamoto K, Wesselman C, Li Y, Zhong X. Genetic polymorphisms in cytochrome P450 oxidoreductase influence microsomal P450-catalyzed drug metabolism. Pharmacogenet Genomics 2008;18(1):11–24. DOI: 10.1097/FPC.0b013e3282f2f121.
30. Nakamoto K, Wang S, Jenison RD, Guo GL, Klaassen CD, Wan YJ, et al. Linkage disequilibrium blocks, haplotype structure, and htSNPs of human CYP7A1 gene. BMC Genet 2006;7(1):29. DOI: 10.1186/1471-2156-7-29.
31. Zhang H-F, Li Z-H, Liu J-Y, Liu T-T, Wang P, Fang Y, et al. Correlation of cytochrome P450 oxidoreductase expression with the expression of 10 isoforms of cytochrome P450 in human liver. Drug Metab Dispos 2016;44(8):1193–1200. DOI: 10.1124/dmd.116.069849.
32. Pecori GF, Verna F, Sesta A, Messina M, Menegatti E, Einanudi S, et al. SAT-346 POR rs2286822 polymorphism is associated with clinical features in patients with congenital adrenal hyperplasia due to 21 hydroxylase deficiency. J Endocr Soc 2019;3 (Suppl. 1):SAT-346. DOI: 10.1210/js.2019-SAT-346.
33. Gong L, Zhang CM, Lv JF, Zhou HH, Fan L. Polymorphisms in cytochrome P450 oxidoreductase and its effect on drug metabolism and efficacy. Pharmacogenet Genomics 2017;27(9):337–346. DOI: 10.1097/FPC.0000000000000297.
34. Hart SN, Li Y, Nakamoto K, Wesselman C, Zhong X. Novel SNPs in cytochrome P450 oxidoreductase. Drug Metab Pharmacokinet 2007;22(4):322–326. DOI: 10.2133/dmpk.22.322.
35. Ensembl genome browser 100 [Internet]. [cited 2020 Jun 1]. Available from: http://asia.ensembl.org/index.html.
36. Home - SNP - NCBI [Internet]. [cited 2020 May 28]. Available from: https://www.ncbi.nlm.nih.gov/snp/.
________________________
© The Author(s). 2020 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (https://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted use, distribution, and non-commercial reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.